32119 Un1Cas12f1 (Cas14a1) Nuclease
32119 Un1Cas12f1 (Cas14a1) Nuclease
-
Specifications:
- 100 pmoL
- 1,000 pmoL
Article number:
32119
Price:Contact our distributors
隐藏域元素占位
Product overview
Description
Un1Cas12f1 (previously known as Un1Cas14a) is an endonuclease that specifically binds and cleaves ssDNA target under the guidance of tracrRNA and crRNA (or sgRNA alone), and does not require a PAM site. In addition, Un1Cas12f1 can also specifically cleave dsDNA target in a PAM-dependent manner, causing DSBs and generating sticky ends. Similar to other Cas12 family proteins, Un1Cas12f1 protein also has the trans-cleavage activity against ssDNA, and both dsDNA or ssDNA targets can trigger its trans-cleavage activity, that is, when Un1Cas12f1 binds sgRNA and target DNA to form a ternary complex, it releases trans-cleavage activity to non-specifically cleave ssDNA sequences in the reaction system.
Compared with other Cas proteins, Cas12f1 protein is generally smaller (400-700 AA). Similar to Cas12a and Cas12b, Cas12f can also be used to develop CRISPR-Dx systems for rapid detection of nucleic acids (For details, please refer to PMID: 30337455).
Product Components
|
组分 |
32119-01 (100 pmol) |
321109-03 (1,000 pmol) |
|
|
100 pmol |
1,000 pmol |
|
|
1 mL |
1 mL |
a.The concentration of Un1Cas12f1 Nuclease is 10 μM (10 pmol/μL);
Storage Conditions
Store at -20℃; transport at ≤0℃.
Experimental Results
In this experiment, the trans-cleavage activities of Un1Cas12f1 against three different ssDNA targets were tested. The ssDNA reporters were labeled with a fluorophore (FAM) at the 5' end and a quencher (BHQ1) at the 3' end. The results showed that Un1Cas12f1 released trans-cleavage activity against ssDNA and cleaved the ssDNA reporters to emit fluorescent signals at the presence of ssDNA target.

Fig 1. Results of Un1Cas12f1 trans-cleavage in the presence of different ssDNA target.
Experiment Procedure
1.Trans-cleavage experiment
|
Components |
Volume |
Final concentration |
|
10 × HOLMES Buffer 1 |
2 μL | 1 × |
|
10 μM Un1Cas12f1 Nuclease |
0.05~0.5 μL | 25~250 nM |
|
10 μM sgRNA |
0.05~0.5 μL | 25~250 nM |
|
10 μM Target DNA |
0.05~0.5 μL | 25~250 nM |
|
10 μM ssDNA Reporter |
0.05~0.5 μL | 25~250 nM |
|
Nuclease-free water |
Up to 20 μL |
◆ Target DNA can be ssDNA or dsDNA with PAM sequence in the trans-cleavage system.
◆ The amount of each component in the trans-cleavage system can be adjusted according to different experimental purposes. When the amount is small, each component can be diluted first and then added to the system. Un1Cas12f1 Nuclease can be diluted with 1×HOLMES Buffer 1, and it must be used immediately after dilution (If you want to store the diluted Cas12 enzyme for a long term, please use Cas12 Dilution Buffer, #32012). sgRNA, Target DNA and ssDNA Reporter can be diluted with Nuclease-free Water, but for extremely low concentrations of Target DNA (such as LOD experiments), it is recommended to dilute with 0.1 % Tween 20 and use low adsorption centrifuge tubes and tips etc.
◆ For the amount of probe used in the trans-cleavage system and the expected reaction time to reach the plateau, please refer to the specific value of transU of each batch of Cas enzyme. For details, please refer to the COA test report provided by Tolo Biotech.
◆ The real-time fluorescent quantitative PCR instrument detects the fluorescent signal from reaction at 37°C, and collects the fluorescent signal every 30 seconds.
FAQ
Q1: What are the common Cas12f enzymes, and how do they differ from the Cas12a and Cas12b families?
A1: Common Cas12f enzymes include Un1Cas12f1, Un2Cas12f1, PtCas12f1, AsCas12f1, RuCas12f1, SpCas12f1, CnCas12f1, Mi1Cas12f2, Mi2Cas12f2, AuCas12f2,etc. These Cas12f proteins recognize PAM sequences rich in T. In general, Cas12f proteins are much smaller, with only 400-700 amino acids (aa), compared to the Class II CRISPR-Cas enzymes known previously (950-1400 aa). Cas12f enzymes require guidance by both crRNA and tracrRNA (or a fused sgRNA). Initially, research from Jennifer Doudna's team suggested that Un1Cas12f1 could only recognize and cleave ssDNA targets (for details, see PMID: 30337455). However, subsequent research from Virginijus Siksnys' team demonstrated that Un1Cas12f1 also possesses PAM-dependent dsDNA target recognition and cleavage capabilities. Different Cas12f enzymes may have slightly different PAM sequences, but they all contain T-rich sequences (for details, see PMID: 32246713). Additionally, both dsDNA and ssDNA targets can activate the trans-cleavage activity of Cas12f, allowing nonspecific cleavage of ssDNA probes. Details of the comparison are shown in the table below:
|
Cas12a(Cpf1) |
Cas12b (C2c1) |
Cas12f (Cas14) |
|
|
Classification |
Class II Type V |
Class II Type V |
Class II Type V |
|
Nuclease Domains |
RuvC only |
RuvC only |
RuvC only |
|
Guide RNA |
crRNA only |
crRNA and tracrRNA |
crRNA and tracrRNA |
|
PAM Sequence |
5´-TTTN-3´ or 5´-TTN-3´ |
5´-TTN-3´ |
T-Rich |
|
Cis-Cleavage Target |
dsDNA with PAM or ssDNA |
dsDNA with PAM or ssDNA |
dsDNA with PAM or ssDNA |
|
Cis-Cleavage Site of dsDNA |
~14/18-23 bp 3´ of the PAM |
~17-24 bp 3´ of the PAM |
~20-24 bp 3’ of the PAM |
|
Cis-Cleavage Site of ssDNA |
~22 nt from the first 3´ guide-complementary base |
/ |
beyond the guide-complementary region |
|
Termini of Cis-Cleavage Products |
5´ overhang |
5´ overhang |
5´ overhang |
|
Trans-Cleavage Target |
ssDNA |
ssDNA |
ssDNA |
Q2: How to design the sgRNA for Un1Cas12f1?
A2: Un1Cas12f1的sgRNA可参照以下序列设计:
5′–CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAA
ACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACNNNNNNNNNNNNNNNNNNNN–3′,
(The black represents the tracrRNA region, gray represents the linker region, blue represents the crRNA region, bold font indicates the anti-repeat region of tracrRNA and the repeat region of crRNA; blue underlines represent the spacer region that complements the specific target sequence, with a recommended length of 20-25 nt).
Q3: What are the requirements for the reaction environment of Un1Cas12f1?
A3: The cleavage reaction of Un1Cas12f1 depends on Mg2+ and can be carried out at temperatures ranging from 37°C to 50°C. Studies have shown that Cas12f enzymes require a low salt concentration environment (5-25 mM) and do not exhibit efficient cleavage activity in reaction systems with 100-150 mM NaCl.
Q4: From a structural perspective, what are the characteristics of Un1Cas12f1?
A4: Structural studies have analyzed the action mechanism of Cas12f proteins. Two noteworthy points are: 1) Cas12f functions as a dimer, where two Cas12f molecules are guided by the same sgRNA; 2) Cas12f proteins have a relatively weak binding affinity for nucleic acid strands from a structural standpoint.
Q5: Where are the cleavage sites for ssDNA targets by Un1Cas12f1?
A5: The cleavage site for ssDNA targets by Un1Cas12f1 is beyond the region complementary to the crRNA and is approximately around the 22nd position (21st-23rd) from the first 3'-base that pairs with the crRNA guide sequence.
Q6: Where are the cleavage sites for dsDNA targets by Un1Cas12f1, and what determines these sites?
A6: Cas12f family members recognize PAM sequences rich in T. However, the exact PAM sequences recognized may vary slightly among different sources of Cas12f. For example, Un1Cas12f1 recognizes a 5′-TTTN-3′ and the cleavage sites for dsDNA targets depend on PAM sequence. The cleavage sites on plasmid dsDNA targets are located around the 20th to 22nd positions on the non-target strand (NTS) and around the 24th position on the target strand (TS) relative to the PAM sequence. The cleavage occurs in an alternating fashion and generates a 5′ overhang.
Q7: Can both dsDNA and ssDNA targets activate the trans-cleavage activity of Un1Cas12f1?
A7: Yes, both dsDNA and ssDNA targets can activate the trans-cleavage activity of Un1Cas12f1.
References
Related Products
Un1Cas12f1 Nuclease (10 μM) a
10 × HOLMES Buffer 1




